MISSION® esiRNA

Name	MISSION® esiRNA
Supplier	Sigma-Aldrich
Catalog	EHU114431
Category	siRNA
Prices	$140.00, $250.00
Sizes	20 µg, 50 µg
Applications	Gene Silencing
Gene	KRAS
Sequence	AGGCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGTGTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAGAGAACAAATTAAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAAATGTGATTTGCCTTCTAGAACAGTAGACACAAAACAGGCTCAGGA
Description	MISSION esiRNA are endo-ribonuclease prepared siRNA
Supplier Page	Shop

Product images

<B>Immunoblotting</B><BR/>KRAS: <B>Cat. No. EHU114431</B>: Western blot analysis of KRAS in HeLa cells.<BR/><B>Lanes</B><BR/>1. HeLa cells transfected with Renilla Luciferase esiRNA (RLUC, <B>Cat. No. EHURLUC</B>) as negative control.<BR/>2. HeLa cells transfected with KRAS esiRNA (<B>Cat. No. EHU114431</B>). Quantitative-Immunoblotting: Lysates were separated on SDS-Page and probed with mouse Monoclonal Anti-c-K-Ras (1:100) Clone: 234-4.2 (<B>Cat. No. R3400</B>) and goat Anti-GAPDH (1:7000) (Acris) antibodies. The signal intensities of indicated bands were quantified using an Odyssey infrared imaging system (Li-COR) and normalized to the GAPDH signal. At 72h post transfection, a 73% KRAS protein reduction was measured between the negative control RLUC and the sample treated with KRAS esiRNA.

Immunoblotting
KRAS: Cat. No. EHU114431: Western blot analysis of KRAS in HeLa cells.
Lanes
1. HeLa cells transfected with Renilla Luciferase esiRNA (RLUC, Cat. No. EHURLUC) as negative control.
2. HeLa cells transfected with KRAS esiRNA (Cat. No. EHU114431). Quantitative-Immunoblotting: Lysates were separated on SDS-Page and probed with mouse Monoclonal Anti-c-K-Ras (1:100) Clone: 234-4.2 (Cat. No. R3400) and goat Anti-GAPDH (1:7000) (Acris) antibodies. The signal intensities of indicated bands were quantified using an Odyssey infrared imaging system (Li-COR) and normalized to the GAPDH signal. At 72h post transfection, a 73% KRAS protein reduction was measured between the negative control RLUC and the sample treated with KRAS esiRNA.